About   Help   FAQ
Mettl11bem1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Mettl11bem1(IMPC)J
Name: methyltransferase like 11B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6284511
Gene: Mettl11b  Location: Chr1:163529825-163552801 bp, - strand  Genetic Position: Chr1, 71.0 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTCCAGCTCTATCCCTAG and TTTGTTGTACACGTGTTTAT, which resulted in a 596 bp deletion beginning at Chromosome 1 position 163,703,825 bp and ending after 163,704,420 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000853217 (exon 3) and 250 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mettl11b Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/10/2022
MGI 6.19
The Jackson Laboratory