Vstm4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vstm4^em1(IMPC)J
• Name: V-set and transmembrane domain containing 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6283592
• Gene: Vstm4 Location: Chr14:32578713-32661448 bp, + strand Genetic Position: Chr14, 19.4 cM
• Alliance: Vstm4^em1(IMPC)J page
• IMPC: Vstm4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAAAGTAAAATAAGACGA and GCAGGACATGACTAATACGG, which resulted in a 900 bp deletion beginning at Chromosome 14 position 32,863,282 bp and ending after 32,864,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000367509 (exon 2) and 501 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a loss of 133 amino acid sequence but remain in frame. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Vstm4 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)