Slc38a6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc38a6^em1(IMPC)J
• Name: solute carrier family 38, member 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6283587
• Gene: Slc38a6 Location: Chr12:73333553-73400823 bp, + strand Genetic Position: Chr12, 30.42 cM
• Alliance: Slc38a6^em1(IMPC)J page
• IMPC: Slc38a6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTTGACTTAAGTACAAGT and TTGACTCTCACACATCAGAG, which resulted in a 377 bp deletion beginning at Chromosome 12 position 73,291,923 bp and ending after 73,292,299 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365160 (exon 3) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 39 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc38a6 Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)