About   Help   FAQ
Sft2d2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sft2d2em1(IMPC)J
Name: SFT2 domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6283505
Gene: Sft2d2  Location: Chr1:165001906-165022007 bp, - strand  Genetic Position: Chr1, 72.51 cM
Alliance: Sft2d2em1(IMPC)J page
IMPC: Sft2d2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATCTACCGCGTTTGAGGG and TGTGTTAGAGATGGTCTGAA, which resulted in a 521 bp deletion beginning at Chromosome 1 position 165,187,898 bp and ending after 165,188,418 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000229846 and ENSMUSE00000229842 (exons 2 and 3) and 348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sft2d2 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory