About   Help   FAQ
Spats2lem1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Spats2lem1(IMPC)Wtsi
Name: spermatogenesis associated, serine-rich 2-like; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6281943
Gene: Spats2l  Location: Chr1:57813321-57987553 bp, + strand  Genetic Position: Chr1, 28.85 cM, cytoband C2
Alliance: Spats2lem1(IMPC)Wtsi page
IMPC: Spats2l gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCTGGTGTTGATTTTAGGCCCAA, CCGGATGTGGCACAACCAGAGTT, CCCACAACTATAAATCCACAGTG, GCAGGCAGGAACATATATCTTGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Spats2l Mutation:  34 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory