Slc25a48^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc25a48^em1(IMPC)J
• Name: solute carrier family 25, member 48; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6280027
• Gene: Slc25a48 Location: Chr13:56585774-56620180 bp, + strand Genetic Position: Chr13, 30.06 cM
• Alliance: Slc25a48^em1(IMPC)J page
• IMPC: Slc25a48 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACATGGCATGATAGGAGA and TTTGAAGGTGGCTTTGACAG, which resulted in a 1016 bp deletion beginning at Chromosome 13 position 56,450,617 bp and ending after 56,451,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000381058 (exon 4) and 757 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc25a48 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)