Cwh43em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Cwh43em1(IMPC)J |
Name: |
cell wall biogenesis 43 C-terminal homolog; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6277995 |
Gene: |
Cwh43 Location: Chr5:73563418-73610778 bp, + strand Genetic Position: Chr5, 38.78 cM
|
Alliance: |
Cwh43em1(IMPC)J page
|
IMPC: |
Cwh43 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATAAGAACTGTGTCTAGTA and CAATGGTCAGAACTTCGCCA, which resulted in a 259 bp deletion beginning at Chromosome 5 position 73,411,781 bp and ending after 73,412,039 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000186304 (exon 3) and 138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 23 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|