About   Help   FAQ
Tppp2em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tppp2em1(IMPC)Mbp
Name: tubulin polymerization-promoting protein family member 2; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6276898
Gene: Tppp2  Location: Chr14:52155887-52158161 bp, + strand  Genetic Position: Chr14, 26.72 cM
Alliance: Tppp2em1(IMPC)Mbp page
IMPC: Tppp2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 3 guide sequences CCGAATGTCTTGGTACTTCTGTC, CCTGGCATAGTTCTAAAGATGGG, CCGCCTGGCATAGTTCTAAAGAT, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tppp2 Mutation:  16 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory