About   Help   FAQ
Zfp507em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp507em1(IMPC)J
Name: zinc finger protein 507; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6275176
Gene: Zfp507  Location: Chr7:35471768-35502428 bp, - strand  Genetic Position: Chr7, 21.37 cM
Alliance: Zfp507em1(IMPC)J page
IMPC: Zfp507 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGAAAGCAACAGGCGCTG and TTAGTTCTAGAATCTCAAGG, which resulted in a 2580 bp deletion beginning at Chromosome 7 position 35,793,294 bp and ending after 35,795,873 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000394835 (exon 3) and 484 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to remove the first 698 amino acids but retain the last 248 before the stop. In addition, there is a 2 bp insertion (GA) 14 bp before the deletion. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp507 Mutation:  46 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory