Adi1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adi1^em1(IMPC)J
• Name: acireductone dioxygenase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6275158
• Gene: Adi1 Location: Chr12:28725230-28732174 bp, + strand Genetic Position: Chr12, 11.05 cM
• Alliance: Adi1^em1(IMPC)J page
• IMPC: Adi1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGAACTGGAATTTCCACC and GCGAGGCAGCATTATCTACA, which resulted in a 2357 bp deletion beginning at Chromosome 12 position 28,677,511 bp and ending after 28,679,867 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000107236 and ENSMUSE00000107235 (exons 2 and 3) and 2057 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40, remove 100 amino acids and retain the last 39 amino acids before the stop. In addition there is a 20 bp AGATACTTATGCTGCCTAGC insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Adi1 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)