Tex28^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tex28^em1(IMPC)J
• Name: testis expressed 28; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6260208
• Gene: Tex28 Location: ChrX:73194550-73211444 bp, - strand Genetic Position: ChrX, 37.79 cM
• Alliance: Tex28^em1(IMPC)J page
• IMPC: Tex28 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAAAGTCTCCAAAGCACCT and GCTCTGAGTAAAGGTACAGA, which resulted in a 510 bp deletion beginning at Chromosome X position 74,151,956 bp and ending after 74,152,465 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000495133 (exon 4) and 374 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 246 and early truncation 1 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tex28 Mutation: 3 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)