Sytl5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sytl5^em1(IMPC)J
• Name: synaptotagmin-like 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6260045
• Gene: Sytl5 Location: ChrX:9751861-9860782 bp, + strand Genetic Position: ChrX, 4.62 cM
• Alliance: Sytl5^em1(IMPC)J page
• IMPC: Sytl5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAGGGGAAAACTAATCGAG and CCTTACGTCATTTCACAACT, which resulted in a 544 bp deletion beginning at Chromosome X position 9,913,615 bp and ending after 9,914,158 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000656653 (exon 3) and 428 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 110 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sytl5 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)