About   Help   FAQ
Ezh2em1Jbn
Endonuclease-mediated Allele Detail
Summary
Symbol: Ezh2em1Jbn
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit; endonuclease-mediated mutation 1, Jeffrey Baron
MGI ID: MGI:6259828
Synonyms: Ezh2(V626M)
Gene: Ezh2  Location: Chr6:47507208-47572309 bp, - strand  Genetic Position: Chr6, 22.92 cM, cytoband B
Alliance: Ezh2em1Jbn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsCRISPR/Cas9 techinology using guide RNA (CCCCAGCCTGCCACATCAGACGG), SpCas9, and a 127 bp single-stranded mutagenic oligo introduce a c.1876 G to A transversion (NM_004456.4). The resultant GTG to ATG bp (V626M aa) substitution in exon 16 of the gene is confirmed through sequencing. (J:267184)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 5 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ezh2 Mutation:  56 strains or lines available
References
Original:  J:267184 Lui JC, et al., Ezh2 Mutations Found in the Weaver Overgrowth Syndrome Cause a Partial Loss of H3K27 Histone Methyltransferase Activity. J Clin Endocrinol Metab. 2018 Apr 1;103(4):1470-1478
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
11/22/2022
MGI 6.22
The Jackson Laboratory