About   Help   FAQ
Ezh2em1Jbn
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Ezh2em1Jbn
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit; endonuclease-mediated mutation 1, Jeffrey Baron
MGI ID: MGI:6259828
Synonyms: Ezh2(V626M)
Gene: Ezh2  Location: Chr6:47507208-47572309 bp, - strand  Genetic Position: Chr6, 22.92 cM, cytoband B
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsCRISPR/Cas9 techinology using guide RNA (CCCCAGCCTGCCACATCAGACGG), SpCas9, and a 127 bp single-stranded mutagenic oligo introduce a c.1876 G to A transversion (NM_004456.4). The resultant GTG to ATG bp (V626M aa) substitution in exon 16 of the gene is confirmed through sequencing. (J:267184)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 5 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ezh2 Mutation:  54 strains or lines available
References
Original:  J:267184 Lui JC, et al., Ezh2 Mutations Found in the Weaver Overgrowth Syndrome Cause a Partial Loss of H3K27 Histone Methyltransferase Activity. J Clin Endocrinol Metab. 2018 Apr 1;103(4):1470-1478
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/19/2021
MGI 6.17
The Jackson Laboratory