About   Help   FAQ
Spc25em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Spc25em1(IMPC)J
Name: SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6259583
Gene: Spc25  Location: Chr2:69024239-69036538 bp, - strand  Genetic Position: Chr2, 39.64 cM, cytoband C3
Alliance: Spc25em1(IMPC)J page
IMPC: Spc25 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATTACACTCTCAGCCTTTAG, AGGTTGACTTTGCTACAGAA, GGGCCCCAAATACATCTATG and CAGACATAAACTCGAAAATG, which resulted in an 8330 bp deletion beginning at Chromosome 2 position 69,196,943 bp and ending after 69,205,272 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291289-ENSMUSE00000165579 (exons 2-6) and 7760 bp of flanking intronic sequence including the start site and splice acceptors and donors and is predicted to result in a null allele. In addition, there is a 57 bp insertion at the deletion site (Chr2:69,196,929-69,196,985). (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Spc25 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory