Klhl24^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klhl24^em1(IMPC)J
• Name: kelch-like 24; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258591
• Gene: Klhl24 Location: Chr16:19916292-19947971 bp, + strand Genetic Position: Chr16, 12.36 cM, cytoband B1
• Alliance: Klhl24^em1(IMPC)J page
• IMPC: Klhl24 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGATATGCTGAACAGTAC and GTAAGTATTCTTGCTTTCAA, which resulted in a 476 bp deletion beginning at Chromosome 16 position 20,114,420 bp and ending after 20,114,895 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130712 (exon 4) and 291 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 307 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Klhl24 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)