Plekhj1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plekhj1^em1(IMPC)J
• Name: pleckstrin homology domain containing, family J member 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258452
• Gene: Plekhj1 Location: Chr10:80631933-80634404 bp, - strand Genetic Position: Chr10, 39.72 cM, cytoband C1
• Alliance: Plekhj1^em1(IMPC)J page
• IMPC: Plekhj1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCACTCCCCAAAACCCA and AATCCTGGTGAGAGGAAGCT, which resulted in a 1061 bp deletion beginning at Chromosome 10 position 80,795,850 bp and ending after 80,796,910 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000306173, ENSMUSE00000306166 and ENSMUSE00001413139 (exons 4-6) and 469 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 48 amino acids later probably by read through after exon 3. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Plekhj1 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)