About   Help   FAQ
Zbtb41em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zbtb41em1(IMPC)J
Name: zinc finger and BTB domain containing 41; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6258441
Gene: Zbtb41  Location: Chr1:139350026-139380743 bp, + strand  Genetic Position: Chr1, 61.36 cM
Alliance: Zbtb41em1(IMPC)J page
IMPC: Zbtb41 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATATATACCCAAATTCACAT, ATACTTGTTGCACTGCCAAA, ATACTTTCCCTCAAATGCTT and ACTTGTGTGACGCCAGGAGC, which resulted in a 431 bp deletion beginning at Chromosome 1 position 139,429,008 bp and ending after 139,429,438 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000659173 (exon 3) and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 372 and early truncation 39 amino acids later. In addition, there is an 8 bp insertion (CTAAAAAA) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zbtb41 Mutation:  48 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory