Zbtb41^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zbtb41^em1(IMPC)J
• Name: zinc finger and BTB domain containing 41; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258441
• Gene: Zbtb41 Location: Chr1:139350026-139380743 bp, + strand Genetic Position: Chr1, 61.36 cM
• Alliance: Zbtb41^em1(IMPC)J page
• IMPC: Zbtb41 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATATATACCCAAATTCACAT, ATACTTGTTGCACTGCCAAA, ATACTTTCCCTCAAATGCTT and ACTTGTGTGACGCCAGGAGC, which resulted in a 431 bp deletion beginning at Chromosome 1 position 139,429,008 bp and ending after 139,429,438 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000659173 (exon 3) and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 372 and early truncation 39 amino acids later. In addition, there is an 8 bp insertion (CTAAAAAA) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zbtb41 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)