About   Help   FAQ
Igdmrem2Takas
Endonuclease-mediated Allele Detail
Summary
Symbol: Igdmrem2Takas
Name: intergenic germline-derived differentially methylated region; endonuclease-mediated mutation 2, Shuji Takada
MGI ID: MGI:6258439
Synonyms: IG-DMRdeltaRep
Gene: Igdmr  Location: Chr12:109492765-109496915 bp  Genetic Position: Chr12, Syntenic
Alliance: Igdmrem2Takas page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe 216-bp tandem repeat sequence of the differentially methylated region between Dlk1 and Gtl2 was targeted using sgRNAs (equivalent to GTCGATCGTGAACTGCAGCCTGG and GGAGAATGCCTTGAGCACAGGGG) with CRISPR/Cas9 technology. Line C257 showed a 420 bp deletion that includes the entire repeat sequence (GRCm39:chr12:109494056-109494475) and was selected for further study. (J:266963)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Igdmr Mutation:  2 strains or lines available
References
Original:  J:266963 Saito T, et al., A tandem repeat array in IG-DMR is essential for imprinting of paternal allele at the Dlk1-Dio3 domain during embryonic development. Hum Mol Genet. 2018 Sep 15;27(18):3283-3292
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory