Igdmr^em2Takas
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igdmr^em2Takas
• Name: intergenic germline-derived differentially methylated region; endonuclease-mediated mutation 2, Shuji Takada
• MGI ID: MGI:6258439
• Synonyms: IG-DMR^deltaRep
• Gene: Igdmr Location: Chr12:109492765-109496915 bp Genetic Position: Chr12, Syntenic
• Alliance: Igdmr^em2Takas page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F2

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The 216-bp tandem repeat sequence of the differentially methylated region between Dlk1 and Gtl2 was targeted using sgRNAs (equivalent to GTCGATCGTGAACTGCAGCCTGG and GGAGAATGCCTTGAGCACAGGGG) with CRISPR/Cas9 technology. Line C257 showed a 420 bp deletion that includes the entire repeat sequence (GRCm39:chr12:109494056-109494475) and was selected for further study. (J:266963)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Igdmr Mutation: 2 strains or lines available

References

• Original: J:266963 Saito T, et al., A tandem repeat array in IG-DMR is essential for imprinting of paternal allele at the Dlk1-Dio3 domain during embryonic development. Hum Mol Genet. 2018 Sep 15;27(18):3283-3292
• All: 2 reference(s)