About   Help   FAQ
Tmem8bem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem8bem1(IMPC)Tcp
Name: transmembrane protein 8B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6257826
Gene: Tmem8b  Location: Chr4:43668971-43692668 bp, + strand  Genetic Position: Chr4, 23.05 cM
Alliance: Tmem8bem1(IMPC)Tcp page
IMPC: Tmem8b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1136 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) having spacer sequences of GGAACCAGGTCCCCGTCTGT and AGTGCCGACGCGCTCACCTA targeting a critical exon. This resulted in a 457-bp del Chr4:43685599 to 43686055 (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 7 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tmem8b Mutation:  42 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory