Syt4em1(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Syt4em1(IMPC)H |
| Name: |
synaptotagmin IV; endonuclease-mediated mutation 1, Harwell |
| MGI ID: |
MGI:6257814 |
| Gene: |
Syt4 Location: Chr18:31570861-31580459 bp, - strand Genetic Position: Chr18, 17.75 cM
|
| Alliance: |
Syt4em1(IMPC)H page
|
| IMPC: |
Syt4 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, 4 guide sequences CATGTGAAGTATTCTCACCCTGG, CCTGTTACATAAATGATGTATAA, CCTTGAGCATTTCAATTGTGGAT, CCTGGCTTTGTTTAACTCAGATA, and a donor oligo, which resulted in a Conditional Ready allele.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Syt4 Mutation: |
26 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|