About   Help   FAQ
Bbox1em2(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Bbox1em2(IMPC)Bay
Name: gamma-butyrobetaine hydroxylase 1; endonuclease-mediated mutation 2, Baylor College of Medicine
MGI ID: MGI:6257756
Gene: Bbox1  Location: Chr2:110094401-110145158 bp, - strand  Genetic Position: Chr2, 56.7 cM, cytoband E3
Alliance: Bbox1em2(IMPC)Bay page
IMPC: Bbox1 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA, 2 guide sequences GGTTCGACAGCACATGTGGTTGG, GCTTTTACTTCAGCTAATTCAGG, and a donor oligo, which resulted in a Conditional Ready allele. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Bbox1 Mutation:  31 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory