Zfp804a^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp804a^em1(IMPC)Tcp
• Name: zinc finger protein 804A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257708
• Gene: Zfp804a Location: Chr2:81883566-82090223 bp, + strand Genetic Position: Chr2, 49.06 cM
• Alliance: Zfp804a^em1(IMPC)Tcp page
• IMPC: Zfp804a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0985 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CACTATTGCCAAAGCTCTGG targeting the 5' side and ATATGACCACGCCCACAAAC targeting the 3' side of a critical region. This resulted in a 102 bp-del Chr2:82235835 to 82235936; in-frame intra-exon deletion deleting amino acids 50-85. The Pfam zinc finger double-stranded RNA binding domain is annotated from amino acid 57-84 amino acids in Ensembl build 38, so this domain is completely removed by this deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp804a Mutation: 54 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)