About   Help   FAQ
Tnk2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tnk2em1(IMPC)Tcp
Name: tyrosine kinase, non-receptor, 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6257705
Gene: Tnk2  Location: Chr16:32462699-32502311 bp, + strand  Genetic Position: Chr16, 23.16 cM
Alliance: Tnk2em1(IMPC)Tcp page
IMPC: Tnk2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1088 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGAACATGGAGTTCGTTCAT and AGAGAGTGGCATCGATCTAC targeting the 5' side and ACCGCAAGGTGCCCTTTGCC targeting the 3' side of a critical region. This resulted in a 320-bp deletion Chr16:32669908 to 32670227 (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tnk2 Mutation:  60 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory