Pbld2em4(IMPC)Bay
Endonuclease-mediated Allele Detail
|
Symbol: |
Pbld2em4(IMPC)Bay |
Name: |
phenazine biosynthesis-like protein domain containing 2; endonuclease-mediated mutation 4, Baylor College of Medicine |
MGI ID: |
MGI:6257687 |
Gene: |
Pbld2 Location: Chr10:62860094-62894592 bp, + strand Genetic Position: Chr10, 32.52 cM, cytoband B4
|
Alliance: |
Pbld2em4(IMPC)Bay page
|
IMPC: |
Pbld2 gene page |
|
Strain of Origin: |
C57BL/6N
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences GAAAAAGACCTAGGATAACTGGG, GCGAATCCAAGTCAGAATGCTGG, which resulted in a Exon Deletion.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Pbld2 Mutation: |
44 strains or lines available
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
2 reference(s) |
|