About   Help   FAQ
Tas2r102em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Tas2r102em1(IMPC)Bay
Name: taste receptor, type 2, member 102; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6257655
Gene: Tas2r102  Location: Chr6:132762131-132763174 bp, + strand  Genetic Position: Chr6, 64.03 cM
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA and 2 guide sequences CCACTTGGTCACCCAGGGACAGG, ATCTATGAGGTAGTTGTTCAAGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tas2r102 Mutation:  10 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/22/2020
MGI 6.16
The Jackson Laboratory