About   Help   FAQ
Ppp1r12cem1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Ppp1r12cem1(IMPC)Bay
Name: protein phosphatase 1, regulatory subunit 12C; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6257650
Gene: Ppp1r12c  Location: Chr7:4484519-4504679 bp, - strand  Genetic Position: Chr7, 2.59 cM, cytoband A1
Alliance: Ppp1r12cem1(IMPC)Bay page
IMPC: Ppp1r12c gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA and 2 guide sequences GAGACTTGCGTAGCTATCGCTGG, CCAAAGCTCTTAATCCCATAGGC, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ppp1r12c Mutation:  33 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory