About   Help   FAQ
Tango2em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Tango2em1(IMPC)Bay
Name: transport and golgi organization 2; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6257625
Gene: Tango2  Location: Chr16:18300825-18348098 bp, - strand  Genetic Position: Chr16, 11.34 cM, cytoband B1
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA and 2 guide sequences AGTCCTTGCTACCCATCCACAGG, CCATTACTAGCCCTATTTGGTGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tango2 Mutation:  16 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory