Lrrc56^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrrc56^em1(IMPC)Tcp
• Name: leucine rich repeat containing 56; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257482
• Gene: Lrrc56 Location: Chr7:140774070-140789968 bp, + strand Genetic Position: Chr7, 86.48 cM
• Alliance: Lrrc56^em1(IMPC)Tcp page
• IMPC: Lrrc56 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1151 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of AAGTGATCCAGTGCTGTCAT targeting the 5' side and ACAAGCCAGAAGGTACACGT and TGTGGAGTCACCTGCTATAA targeting the 3' side of a critical exon. This resulted in a 997-bp del Chr7:141205029 to 141206025 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lrrc56 Mutation: 21 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)