Akap8lem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Akap8lem1(IMPC)J |
Name: |
A kinase anchor protein 8-like; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6231175 |
Gene: |
Akap8l Location: Chr17:32540398-32569581 bp, - strand Genetic Position: Chr17, 17.5 cM, cytoband B2
|
Alliance: |
Akap8lem1(IMPC)J page
|
IMPC: |
Akap8l gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTCTGCCTAGGAAAAACGG and TGGAGTCAAGAGACTCCAAA, which resulted in a 964 bp deletion beginning at Chromosome 17 position 32,335,377 bp and ending after 32,336,340 bp (GRCm38/mm10). This mutation deletes the last 56 bp of ENSMUSE00000137572 (exon 5), all of ENSMUSE00000137565, ENSMUSE00000137575, and ENSMUSE00000137582 (exons 6, 7, 8), and 679 bp of flanking intronic sequence including the splice acceptors and donors. This is predicted to cause a change of amino acid sequence after residue 254 and early truncation 11 amino acids later due to read through into the intron between exons 8 and 9.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|