Cmya5em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Cmya5em1(IMPC)J |
Name: |
cardiomyopathy associated 5; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6209671 |
Gene: |
Cmya5 Location: Chr13:93177221-93281232 bp, - strand Genetic Position: Chr13, 47.81 cM, cytoband C3
|
Alliance: |
Cmya5em1(IMPC)J page
|
IMPC: |
Cmya5 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGTTTCAGCACTCGACA and GTTATCAGATGAGGATGAGG, which resulted in a 9281 bp deletion beginning at Chromosome 13 position 93,089,133 bp and ending after 93,098,413 bp (GRCm38/mm10). This mutation deletes 9281 bp from ENSMUSE00000356892 (exon 2) and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 3 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|