About   Help   FAQ
Avpr1aem1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Avpr1aem1(IMPC)J
Name: arginine vasopressin receptor 1A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6208800
Gene: Avpr1a  Location: Chr10:122448499-122453452 bp, + strand  Genetic Position: Chr10, 70.36 cM, cytoband D3
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGGCTGGAGAAATTCCG and TAGAAGCTTAACTATTGAAT, which resulted in a 1550 bp deletion beginning at Chromosome 10 position 122,448,382 bp and ending after 122,449,931 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000100823 (exon 1) and 259 bp of flanking intronic sequence including the start of translation and splice donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Avpr1a Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/30/2020
MGI 6.15
The Jackson Laboratory