Trex1^em1Aiwsk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trex1^em1Aiwsk
• Name: three prime repair exonuclease 1; endonuclease-mediated mutation 1, Akiko Iwasaki
• MGI ID: MGI:6201209
• Gene: Trex1 Location: Chr9:108887000-108888791 bp, - strand Genetic Position: Chr9, 59.63 cM
• Alliance: Trex1^em1Aiwsk page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 is used to remove the single coding exon of the gene. Two single guide RNAs (sgRNAs) were employed: CTGTTAATTAGCCTAACAGG in the region upstream of the coding exon, and TCAGGGTAATTCCCGAAGAG in the downstream region. The intervening sequence was excised. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trex1 Mutation: 29 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)