About   Help   FAQ
Tspyl1em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Tspyl1em1(IMPC)J
Name: testis-specific protein, Y-encoded-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6200424
Gene: Tspyl1  Location: Chr10:34158186-34160881 bp, + strand  Genetic Position: Chr10, 18.85 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGTCCCCTCGTCCCGCTCC and GCTCCCTTATTGGGCGACGT, which resulted in a 1076 bp deletion beginning at Chromosome 10 position 34,282,295 bp and ending after 34,283,370 bp (GRCm38/mm10). This mutation deletes 1076 bp of ENSMUSE00000350290 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 57 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tspyl1 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/12/2022
MGI 6.17
The Jackson Laboratory