Mrgprg^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrgprg^em1(IMPC)J
• Name: MAS-related GPR, member G; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6200361
• Gene: Mrgprg Location: Chr7:143317447-143320730 bp, - strand Genetic Position: Chr7, 88.31 cM
• Alliance: Mrgprg^em1(IMPC)J page
• IMPC: Mrgprg gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mrgprg-115062J-8267M was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGCCCCCCAAGACCTGAC and TGTTCTCCATATTCAACATC, which resulted in an 819 bp deletion beginning at Chromosome 7 position 143,764,544 bp and ending after 143,765,362 bp (GRCm38/mm10). This mutation deletes 819 bp of ENSMUSE00000378852 (exon 2) and is predicted to cause a deletion of 273 amino acids after residue 4 and before residue 277. This would effectively remove all but 16 amino acids of the coding sequence. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mrgprg Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)