Mecp2^em4Bird
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mecp2^em4Bird
• Name: methyl CpG binding protein 2; endonuclease-mediated mutation 4, Adrian Bird
• MGI ID: MGI:6199505
• Synonyms: CTD1
• Gene: Mecp2 Location: ChrX:73070198-73129296 bp, - strand Genetic Position: ChrX, 37.63 cM
• Alliance: Mecp2^em4Bird page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/CaOlaHsd)F2

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Intragenic deletion
• Mutation details: A deletion was engineered in exon 4 using synthetic tracrRNA (trans-activating crRNA), crRNA (CRISPR RNA) (target sequence ACCTGAGCCTGAGAGCTCTG) and an oligonucleotide repair template using CRISPR/Cas9 technology. This mutation is associated with human Rett syndrome. The mRNA levels from this allele are 45% of wild-type and protein expression 10%. (J:265095)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mecp2 Mutation: 46 strains or lines available

References

• Original: J:265095 Guy J, et al., A mutation-led search for novel functional domains in MeCP2. Hum Mol Genet. 2018 Jul 15;27(14):2531-2545
• All: 1 reference(s)