About   Help   FAQ
Mecp2em4Bird
Endonuclease-mediated Allele Detail
Summary
Symbol: Mecp2em4Bird
Name: methyl CpG binding protein 2; endonuclease-mediated mutation 4, Adrian Bird
MGI ID: MGI:6199505
Synonyms: CTD1
Gene: Mecp2  Location: ChrX:73070198-73129296 bp, - strand  Genetic Position: ChrX, 37.63 cM
Alliance: Mecp2em4Bird page
Mutation
origin
Strain of Origin:  (C57BL/6J x CBA/CaOlaHsd)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Intragenic deletion
 
Mutation detailsA deletion was engineered in exon 4 using synthetic tracrRNA (trans-activating crRNA), crRNA (CRISPR RNA) (target sequence ACCTGAGCCTGAGAGCTCTG) and an oligonucleotide repair template using CRISPR/Cas9 technology. This mutation is associated with human Rett syndrome. The mRNA levels from this allele are 45% of wild-type and protein expression 10%. (J:265095)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mecp2 Mutation:  46 strains or lines available
References
Original:  J:265095 Guy J, et al., A mutation-led search for novel functional domains in MeCP2. Hum Mol Genet. 2018 Jul 15;27(14):2531-2545
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory