Apobr^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Apobr^em1(IMPC)J
• Name: apolipoprotein B receptor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6198556
• Gene: Apobr Location: Chr7:126184114-126188284 bp, + strand Genetic Position: Chr7, 69.17 cM
• Alliance: Apobr^em1(IMPC)J page
• IMPC: Apobr gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAGGACACAAACGCACTGA and GTTGCTGTGAACATCCCCTG, which resulted in a 2414 bp deletion beginning at Chromosome 7 position 126,585,381 bp and ending after 126,587,794 bp (GRCm38/mm10). This mutation deletes 2414 bp of (ENSMUSE00000349153) (exon 2) and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Apobr Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)