Rr62^em1Lap
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr62^em1Lap
• Name: regulatory region 62; endonuclease-mediated mutation 1, Len A Pennacchio
• MGI ID: MGI:6197952
• Synonyms: hs1467 ^-
• Gene: Rr62 Location: unknown Genetic Position: Chr11, Syntenic
• Alliance: Rr62^em1Lap page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting using two sgRNAs (targeting ATCTTTTGTCGGCCATTGAAAGG and TTTGTTCTACGCTGACTTGTTGG) removed the ortholog of human enhancer hs1467 located 954 kb upstream of Sox9. (J:261810)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr62 Mutation: 0 strains or lines available

References

• Original: J:261810 Osterwalder M, et al., Enhancer redundancy provides phenotypic robustness in mammalian development. Nature. 2018 Feb 8;554(7691):239-243
• All: 1 reference(s)