Cabp2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Cabp2em1(IMPC)J |
Name: |
calcium binding protein 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6195841 |
Gene: |
Cabp2 Location: Chr19:4131578-4137340 bp, + strand Genetic Position: Chr19, 3.79 cM, cytoband A
|
Alliance: |
Cabp2em1(IMPC)J page
|
IMPC: |
Cabp2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGAAGACTGTGGGAACAG, GTGCGCTGTTCCAAACGCCC, GACACAGAAAGAGGGTGCCG and TTGTTATTAAAGGGAGAGCA, which resulted in a 954 bp deletion beginning at Chromosome 19 position 4,084,827 bp and ending after 4,085,780 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145610 and ENSMUSE00000145606 (exon 2,3) and 788 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 12 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|