Fam83aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Fam83aem1(IMPC)J |
Name: |
family with sequence similarity 83, member A; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6195295 |
Gene: |
Fam83a Location: Chr15:57848815-57874405 bp, + strand Genetic Position: Chr15, 24.17 cM
|
Alliance: |
Fam83aem1(IMPC)J page
|
IMPC: |
Fam83a gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGCGTCACTTACTAACT, GTTTTATCACAATTCCTAAG, TGAGGGCGTCACTTACTAAC and GGGAGCAGCCATCATCCAGC, which resulted in a 222 bp deletion beginning at Chromosome 15 position 57,995,181 bp and ending after 57,995,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000867629 (exon 3) and 97 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 216 and early truncation 24 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|