Dusp23^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dusp23^em1(IMPC)J
• Name: dual specificity phosphatase 23; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6194214
• Gene: Dusp23 Location: Chr1:172458336-172460504 bp, - strand Genetic Position: Chr1, 80.05 cM, cytoband H3
• Alliance: Dusp23^em1(IMPC)J page
• IMPC: Dusp23 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGCCAATGCCCGGGGAG and GGAAGCACCCAGGAGAAGTT, which resulted in a 263 bp deletion beginning at Chromosome 1 position 172,632,616 bp and ending after 172,632,878 bp (GRCm38/mm10). This mutation creates an internal deletion of 263 bp in ENSMUSE00000160363 (exon 1) resulting in a frame shift that is predicted to cause a change of amino acid sequence after residue 2 and early truncation 33 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dusp23 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)