About   Help   FAQ
Ttc7bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttc7bem1(IMPC)J
Name: tetratricopeptide repeat domain 7B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6189597
Gene: Ttc7b  Location: Chr12:100267029-100487085 bp, - strand  Genetic Position: Chr12, 50.43 cM
Alliance: Ttc7bem1(IMPC)J page
IMPC: Ttc7b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATAACACATTCAACAGAACG, CCTGAGCACCTCACGCCCCG, GTGGATACACTGATCAGGCA and TCTTGGAGTCCATAACTATG, which resulted in a 519 bp deletion beginning at Chromosome 12 position 100,499,950 bp and ending after 100,500,468 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000411339 (exon 2) and 364 bp of flanking intronic sequence including the splice acceptor and donor. There is also a single bp insertion (A) at the deletion site that will not alter the results of the deletion. This exon deletion is predicted to cause a change of amino acid sequence after residue 40 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ttc7b Mutation:  51 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory