About   Help   FAQ
Hspd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Hspd1em1(IMPC)J
Name: heat shock protein 1 (chaperonin); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6188980
Gene: Hspd1  Location: Chr1:55116994-55127402 bp, - strand  Genetic Position: Chr1, 28.01 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTACAACGAATGTAATAAAA, GGTGGCATCTGTTAGTACCA, AAGACAACAGAATTCTTTAC and TTGAGATTCATGTTGCAGGA, which resulted in a 469 bp deletion beginning at Chromosome 1 position 55,084,501 bp and ending after 55,084,969 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374725 (exon 3) and 216 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp insertion (G) at the deletion site as well as an indel with a 5 bp insert (GTCTC) and 4 bp deletion (TTAT) 29 bp after the 469 bp deletion that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 58 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hspd1 Mutation:  38 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/12/2022
MGI 6.17
The Jackson Laboratory