Mical3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Mical3em1(IMPC)J |
Name: |
microtubule associated monooxygenase, calponin and LIM domain containing 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6188966 |
Gene: |
Mical3 Location: Chr6:120908668-121107959 bp, - strand Genetic Position: Chr6, 57.03 cM
|
Alliance: |
Mical3em1(IMPC)J page
|
IMPC: |
Mical3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGAAGGCAGGTTATAGACCA, GCTTGAGGTAGACATGCCAG, TTTTGTACAAGAGCCCCACT and AGATCGGCAAAACTTAAATG, which resulted in a 641 bp deletion beginning at Chromosome 6 position 121,040,118 bp and ending after 121,040,758 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001050613 (exon 3) and 443 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 4 bp insertion (GATC) and a 5 bp deletion (TTTAA) 59 bp before the start of the exon deletion, that will not alter the results of the deletion, which is predicted to cause a change of amino acid sequence after residue 88 and early truncation 6 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|