About   Help   FAQ
Sec62em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Sec62em1(IMPC)J
Name: SEC62 homolog (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6188014
Gene: Sec62  Location: Chr3:30847025-30875412 bp, + strand  Genetic Position: Chr3, 14.29 cM, cytoband A3
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGCATTTTCATTACCGTTGA, CTAATTGTTATCCTTCACCA, GTTGATTATTCAGAGATTGA and TATTTACCAGAGCTACTGAA, which resulted in a 537 bp deletion beginning at Chromosome 3 position 30,800,839 bp and ending after 30,801,375 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000172459 (exon 3) and 431 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sec62 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/03/2022
MGI 6.19
The Jackson Laboratory