Rigiem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Rigiem1(IMPC)J |
Name: |
RNA sensor RIG-I; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6164046 |
Gene: |
Rigi Location: Chr4:40203773-40239828 bp, - strand Genetic Position: Chr4, 20.24 cM
|
Alliance: |
Rigiem1(IMPC)J page
|
IMPC: |
Rigi gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TATGGGTTTCAATTATCCTT, TTAGAGGTGACCACACCCTG, CAAACAGTGCAACAATTAAA and GGGAATCCTGTTCAAATCAG, which resulted in a total of 688 bp deletion beginning at Chromosome 4 position 40,229,215 bp for 523 bp followed by a 4 bp endogenous retention (TCTA) then a further 165 bp deletion ending after 40,229,902 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001299001 (exon 3) and 506 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 4 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
5 reference(s) |
|