Srsf5em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Srsf5em1(IMPC)J |
Name: |
serine and arginine-rich splicing factor 5; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6164004 |
Gene: |
Srsf5 Location: Chr12:80992308-80997277 bp, + strand Genetic Position: Chr12, 37.2 cM, cytoband D2
|
Alliance: |
Srsf5em1(IMPC)J page
|
IMPC: |
Srsf5 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTATAGTATCTGAGTGTA and TAGGGTCCGTTAGCATTAAA, which resulted in a 694 bp deletion beginning at Chromosome 12 position 80,947,084 bp and ending after 80,947,777 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244447 and ENSMUSE00001218869 (exons 3 and 4) and 524 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 13 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|