Trank1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trank1^em1(IMPC)J
• Name: tetratricopeptide repeat and ankyrin repeat containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6161422
• Gene: Trank1 Location: Chr9:111140807-111224843 bp, + strand Genetic Position: Chr9, 60.95 cM, cytoband F2
• Alliance: Trank1^em1(IMPC)J page
• IMPC: Trank1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 4 guide sequences CTTAACCCCCTAAAAGGACG, AAAGCAATCAAATCAAGAGG, ATATTTGTATTGATTGGTGT and AGAAGAGCAAGTGCGTTCAA, which resulted in a 606 bp deletion beginning at Chromosome 9 position 111,333,325 bp and ending after 111,333,930 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000366889(exon 2) and 479 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 48 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trank1 Mutation: 135 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)