Ccdc8em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ccdc8em2(IMPC)Tcp |
| Name: |
coiled-coil domain containing 8; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6157332 |
| Gene: |
Ccdc8 Location: Chr7:16727827-16731440 bp, + strand Genetic Position: Chr7, 9.15 cM
|
| Alliance: |
Ccdc8em2(IMPC)Tcp page
|
| IMPC: |
Ccdc8 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0586 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CCAGCCAGGCGGACCTCCCG and GATACGGGCCACATCTTCCA targeting the 5' side and CCAGGAGCCTCCGGGTACTA and TCCCAGTAGCTAACAAAGGC targeting the 3' side of exon ENSMUSE00000599706 resulting in a 121-bp deletion of Chr7 from 16994632 to 16994752, and c.197delC (22-bp downstream of gRNA_U3).
(J:237616)
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
1 reference(s) |
|