Trarg1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trarg1^em2(IMPC)Tcp
• Name: trafficking regulator of GLUT4 (SLC2A4) 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6157331
• Gene: Trarg1 Location: Chr11:76570699-76589490 bp, + strand Genetic Position: Chr11, 45.98 cM
• Alliance: Trarg1^em2(IMPC)Tcp page
• IMPC: Trarg1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0451 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AGAATCGAAGCGTCCACAGC and TACATCTACCCTCGTCCTGG targeting the 5' side and TCGGGTGTTAGAGCCTTGGC and GCCTTAGGCCCCCTCTAGAA targeting the 3' side of exon ENSMUSE00000346888 (exon 1). This resulted in a 679 bp deletion and 2 bp insertion of Chr11 from 76679972 to 76680650, and a 15 bp deletion and 7 bp insertion of Chr11 from 76680678 to 76680692. (GRCm38). (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trarg1 Mutation: 13 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)