Polr3b^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr3b^em2(IMPC)Tcp
• Name: polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6156605
• Gene: Polr3b Location: Chr10:84458156-84563042 bp, + strand Genetic Position: Chr10, 41.58 cM, cytoband C1
• Alliance: Polr3b^em2(IMPC)Tcp page
• IMPC: Polr3b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and a guide with spacer sequence TCATGTCCCTCAGACGGCAC that targeted exon(s) ENSMUSE00000292306.2. This resulted in deletion(s) of 2 bp (location: Chr10:84468321-84468322; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Polr3b Mutation: 100 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)