Polr3b^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr3b^em2(IMPC)Tcp
• Name: polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6156605
• Gene: Polr3b Location: Chr10:84458156-84563042 bp, + strand Genetic Position: Chr10, 41.58 cM, cytoband C1
• Alliance: Polr3b^em2(IMPC)Tcp page
• IMPC: Polr3b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA having the spacer sequence TCATGTCCCTCAGACGGCAC resulting in a 2-bp deletion on Chr10:84632457-84632458_delCC (GRCm38). (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Polr3b Mutation: 100 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)